View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0200_1D_low_18 (Length: 266)
Name: NF0200_1D_low_18
Description: NF0200_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0200_1D_low_18 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 39 - 266
Target Start/End: Original strand, 29656408 - 29656635
Alignment:
| Q |
39 |
aacacattttacagtctcaaactaacatcatcagatcaacctaaatggatacaccatcttcattaatgggttattttcattggctatatatgtctagtct |
138 |
Q |
| |
|
|||||||||||| |||||||||||||| || |||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29656408 |
aacacattttacggtctcaaactaacaccaccagatcaacctaaatggatacaccatcttcgttaatcggttattttcattggctatatatgtctagtct |
29656507 |
T |
|
| Q |
139 |
agagcattctttgacgta----atatgctctaatttccattttacttctctcttataagcagcttctagcagaatagtatttcaatgaccctcattctat |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29656508 |
agagcattctttgacgtaatttatatgctctaatttccattttacttttctcttataagcagcttctagcagaatagtatttcaatgac-----ttctat |
29656602 |
T |
|
| Q |
235 |
catttccctttctctacatactt-gtagtttct |
266 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
29656603 |
catttccctttctctacatacttggtagtttct |
29656635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2560 times since January 2019
Visitors: 2401