View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0200_1D_low_25 (Length: 219)
Name: NF0200_1D_low_25
Description: NF0200_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0200_1D_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 24 - 212
Target Start/End: Original strand, 11190963 - 11191151
Alignment:
Q |
24 |
gttggtacctagaaggccaatatctgggcatatttctagcaatgattgtcgtaaggttgtgtttagagttggatcaggaactccggtgccattgaaattg |
123 |
Q |
|
|
|||||||||||||| ||||||||||||||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
11190963 |
gttggtacctagaacgccaatatctgggcatattgcttgcaatgattgtagtaaggttgtgtttagagttggatcaggaactccggtgttattgaaattg |
11191062 |
T |
 |
Q |
124 |
tacaatcgatcattgaataaaaggcatacacctcttccaatcgtatgagcacctaaaaaatgatcaaagcatatacaattaaacaccaa |
212 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
11191063 |
tacattcgatcattgaataaaaggcatacacctcttccaatcgtatgagcacctaaaaaatgatcaaagcatatacaattagacaccaa |
11191151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University