View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0200_1D_low_32 (Length: 202)
Name: NF0200_1D_low_32
Description: NF0200_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0200_1D_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 3e-96; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 1 - 186
Target Start/End: Original strand, 709747 - 709932
Alignment:
| Q |
1 |
gcgtggtcgaccaaaaggttcaaaatgtggaaaggagattgtcttagaggttaataatgaagttgttggtgccgaggttatcagtgaagttgctggtgct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
709747 |
gcgtggtcgaccaaaaggttcaaaatgtggaaaggagattgtcctagaggttaataatgaagttgttggtgccgaggttatcattgaagttgctggtgct |
709846 |
T |
|
| Q |
101 |
ggcgagattgcaaggcctaagaagcttggtcggctggaagggtcaaaatgtgggaaggagattgtcgtggaggttagtaatgatgt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
709847 |
ggcgagattgcaaggcctaagaagcttggtcggctggaagggtcaaaatgtgggaaggagattgtcgtggaggttagtaatgatgt |
709932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 81; E-Value: 2e-38
Query Start/End: Original strand, 74 - 186
Target Start/End: Original strand, 709607 - 709719
Alignment:
| Q |
74 |
gaggttatcagtgaagttgctggtgctggcgagattgcaaggcctaagaagcttggtcggctggaagggtcaaaatgtgggaaggagattgtcgtggagg |
173 |
Q |
| |
|
||||||| |||||||||||||||||| || |||||||||||||||||||||||||||||| |||||| |||||||| ||||||||||||||||| |||| |
|
|
| T |
709607 |
gaggttagcagtgaagttgctggtgccggtgagattgcaaggcctaagaagcttggtcggatggaagcatcaaaatgcgggaaggagattgtcgtagagg |
709706 |
T |
|
| Q |
174 |
ttagtaatgatgt |
186 |
Q |
| |
|
||||||||||||| |
|
|
| T |
709707 |
ttagtaatgatgt |
709719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 709960 - 710033
Alignment:
| Q |
1 |
gcgtggtcgaccaaaaggttcaaaatgtggaaaggagattgtcttagaggttaataatgaagttgttggtgccg |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
709960 |
gcgtggtcgaccaaaaggttcaaaatgtggaaaggagattgtggtagaggttaatcatgaagttgctggtgccg |
710033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 85 - 132
Target Start/End: Original strand, 710017 - 710064
Alignment:
| Q |
85 |
tgaagttgctggtgctggcgagattgcaaggcctaagaagcttggtcg |
132 |
Q |
| |
|
||||||||||||||| || |||||||||||| ||||||||| |||||| |
|
|
| T |
710017 |
tgaagttgctggtgccggtgagattgcaaggtctaagaagcgtggtcg |
710064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 71
Target Start/End: Original strand, 709884 - 709940
Alignment:
| Q |
15 |
aaggttcaaaatgtggaaaggagattgtcttagaggttaataatgaagttgttggtg |
71 |
Q |
| |
|
|||| ||||||||||| |||||||||||| | ||||||| |||||| |||| ||||| |
|
|
| T |
709884 |
aagggtcaaaatgtgggaaggagattgtcgtggaggttagtaatgatgttgctggtg |
709940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1452 times since January 2019
Visitors: 2391