View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0200_low_3 (Length: 286)
Name: NF0200_low_3
Description: NF0200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0200_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 66 - 237
Target Start/End: Original strand, 43459113 - 43459284
Alignment:
| Q |
66 |
ggagaaacccaatagccccacacccaccaatctggaacgtcacctgttaacgtaaaagcttaatcatattggcgagcttaattaacgtattacatagttt |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43459113 |
ggagaaacccaatagccccacacccaccaatttggaacgtcacctgttaacgtaaaagcttaatcatattggcgagcttaattaacgtattacatagttt |
43459212 |
T |
|
| Q |
166 |
agtcctttaattagagtttgattagtgactcacgtttaggaaggatgaaacctccaagtaggaaaacaagaa |
237 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43459213 |
agtcccttaattagagtttgattagtgactcacgtttaggaaggatgaaacctccaagtaggaaaacaagaa |
43459284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 193 - 234
Target Start/End: Complemental strand, 4499822 - 4499781
Alignment:
| Q |
193 |
actcacgtttaggaaggatgaaacctccaagtaggaaaacaa |
234 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
4499822 |
actcacgtttaggaaggatgaaaccaccaagtagaaaaacaa |
4499781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 990 times since January 2019
Visitors: 2388