View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0201_high_7 (Length: 275)

Name: NF0201_high_7
Description: NF0201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0201_high_7
NF0201_high_7
[»] chr5 (1 HSPs)
chr5 (35-233)||(34228172-34228370)


Alignment Details
Target: chr5 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 35 - 233
Target Start/End: Original strand, 34228172 - 34228370
Alignment:
35 cagagagctaaaacgcaccggatcaggagggtgacttgaatactaaatattttcatatgtcagcaatgacgaggatcaagaagaagaaggtaactaaatt 134  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||    
34228172 cagagagctaaaacgcaccggatcaggagggtgacttgaatactaaatattttcatatgtcaacaatgatgaggatcaagaagaagaaggtaactaaatt 34228271  T
135 ggttaacgattgacgcgaggaggttactagccaagaggagttgtgtgatgtagctaagaaatattttgatgagttgttcaggcctaatgatgatgtcca 233  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||    
34228272 ggttaacgattgacgcgaggaggttactagccaagaggagttgtgtgatgtagccaagaaatattttgatgagttgttcaggcctaatgatggtgtcca 34228370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2397 times since January 2019
Visitors: 2400