View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0201_low_13 (Length: 275)
Name: NF0201_low_13
Description: NF0201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0201_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 35 - 233
Target Start/End: Original strand, 34228172 - 34228370
Alignment:
| Q |
35 |
cagagagctaaaacgcaccggatcaggagggtgacttgaatactaaatattttcatatgtcagcaatgacgaggatcaagaagaagaaggtaactaaatt |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34228172 |
cagagagctaaaacgcaccggatcaggagggtgacttgaatactaaatattttcatatgtcaacaatgatgaggatcaagaagaagaaggtaactaaatt |
34228271 |
T |
 |
| Q |
135 |
ggttaacgattgacgcgaggaggttactagccaagaggagttgtgtgatgtagctaagaaatattttgatgagttgttcaggcctaatgatgatgtcca |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34228272 |
ggttaacgattgacgcgaggaggttactagccaagaggagttgtgtgatgtagccaagaaatattttgatgagttgttcaggcctaatgatggtgtcca |
34228370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University