View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0201_low_14 (Length: 261)
Name: NF0201_low_14
Description: NF0201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0201_low_14 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 261
Target Start/End: Complemental strand, 43674220 - 43673959
Alignment:
| Q |
1 |
atctatcgcaccagaccatgtgttactctccaccactcgcatcaaacctaggtgattctaggcaactgaagctcaaatttggcgttagatatgatgatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43674220 |
atctatcgcaccagaccatgtgttactctccaccactcgcatcaaacctaggtgattctaggcaactgaagctcaaatttggcgttagatatgatgatgg |
43674121 |
T |
|
| Q |
101 |
acccatgtggnnnnnnncaaacccagtgattggattttcaaagaaaatgtgggttacacttaaaaccaccttattgga-aagacaaattaatgaaaaatg |
199 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43674120 |
acccatgtggaaaaaaacaaacccagtgattggattttcaaagaaaatgtgggttacacttaaaaccaccttattggagaagacaaattaatgaaaaatg |
43674021 |
T |
|
| Q |
200 |
ttgttaaaaaggaaatactgcctaccatgcctaattcctcggcatcccaactgcagagaacg |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43674020 |
ttgttaaaaaggaaatactgcctaccatgccaaattcctcggcatcccaactgcagagaacg |
43673959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2296 times since January 2019
Visitors: 2400