View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0201_low_17 (Length: 251)
Name: NF0201_low_17
Description: NF0201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0201_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 5 - 222
Target Start/End: Original strand, 37721381 - 37721601
Alignment:
Q |
5 |
cagcacagagaacaagcgagaaagaaactccggcgtaaacaaaccaccacaacgtaccgaacggaacatcgtcgccgtcggtaacgaaagaatcattctt |
104 |
Q |
|
|
||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37721381 |
cagcaaagagaacaagcgagaaagaaactccggcgtaaacaaaccaccataacgtaccgaacggaacatcgtcgccgtcggtaacgaaagaatcattctt |
37721480 |
T |
 |
Q |
105 |
tctagcgaggaggtttnnnnnnnnnnnnnnnnngttctgagggaacannnnnnngttatgaaattcagaattgtgaattttgttctttact---taataa |
201 |
Q |
|
|
|||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
37721481 |
tctagcgaggaggtttagaagaagaagaagaaggttctgagggaacatttttttgttatgaaattcagaattgtgaattttgttctttacttaataataa |
37721580 |
T |
 |
Q |
202 |
taatagcaactgactacaaac |
222 |
Q |
|
|
|||||| |||||||||||||| |
|
|
T |
37721581 |
taatagtaactgactacaaac |
37721601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University