View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0201_low_21 (Length: 249)

Name: NF0201_low_21
Description: NF0201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0201_low_21
NF0201_low_21
[»] chr4 (1 HSPs)
chr4 (1-73)||(37279023-37279095)


Alignment Details
Target: chr4 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 37279023 - 37279095
Alignment:
1 aacatatttgagccatatgaaattgttctctttggttcataaacagtttagtgcgaacattttatagtataat 73  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
37279023 aacatatttgagccatatgaaattgttctctttggttcataaacagtttagtgcgaacattttaaagtataat 37279095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University