View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0201_low_30 (Length: 203)
Name: NF0201_low_30
Description: NF0201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0201_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 6753152 - 6753021
Alignment:
| Q |
1 |
ctagagctatagtgatagattgaaaatagttatctataatctcaatatcatatgtgcaattttgagattttaatatccatatccctccagagtgtccacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6753152 |
ctagagctatagtgatagattgaaaatagttatctataatctcaatatcatatgtgcaattttgagattttaatatccatatccctccagagtgtccacg |
6753053 |
T |
|
| Q |
101 |
agcttcagaaattgcacaatcctcatagccta |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6753052 |
agcttcagaaattgcacaatcctcatagccta |
6753021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 124; Significance: 5e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 5e-64
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 1811382 - 1811513
Alignment:
| Q |
1 |
ctagagctatagtgatagattgaaaatagttatctataatctcaatatcatatgtgcaattttgagattttaatatccatatccctccagagtgtccacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1811382 |
ctagagctatagtgatagattgaaaatagttatctataatctcaatatcatatgtgcaattttgagattttaatatccatatacctccagagtgtccacg |
1811481 |
T |
|
| Q |
101 |
agcttcagaaattgcacaatcctcatagccta |
132 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |
|
|
| T |
1811482 |
agcttcagaaattgcacaattctcatagccta |
1811513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2867 times since January 2019
Visitors: 2404