View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0201_low_9 (Length: 314)
Name: NF0201_low_9
Description: NF0201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0201_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 19 - 305
Target Start/End: Original strand, 6362332 - 6362618
Alignment:
| Q |
19 |
acatcatcataaccggatattcctttcataccaggatgaacacagcatacctcgtccgtttttgcccacataccctgcatggctgcaaggtcgccattcc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6362332 |
acatcatcataaccggatattcctttcataccaggatgaacacagcatacctcgtccatttttgcccacataccttgcatggctgcaaggtcgccattcc |
6362431 |
T |
|
| Q |
119 |
tgaatgaatcataaaacttgctgtttgctccaaatactgctgtgttgctatctttttgtaggttttttagtgtatcccttatttctgcagctttagcata |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6362432 |
tgaatgaatcataaaacttgctgtttgctccaaatactgctgtgttgctatctttttgtaggttttttagtgtatcccttatttctgcagctttagcata |
6362531 |
T |
|
| Q |
219 |
attctcctcagcaattgcattctgtagctcttcctctaaagtgttttcatctaatgcaatgtcctcactgctcaacatgctctctgc |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6362532 |
attctcctcagcaattgcattctgtagctcttcctctaaagtgttttcatctaatgcaatgtcctcactgctcaacatgctctctgc |
6362618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1834 times since January 2019
Visitors: 2394