View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0202_high_4 (Length: 289)
Name: NF0202_high_4
Description: NF0202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0202_high_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 49 - 222
Target Start/End: Original strand, 30947053 - 30947226
Alignment:
Q |
49 |
gatgaagaaaagctgttacatgaaattccaagtttgaagttatgtaagaaacatatcaaagtgccggtagttcttattcttttaattttccacgctttca |
148 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
30947053 |
gatgaagaaaagctgttacatgaaattccaagtttgaagttatgtaagaaacatatcaaagtgccggtagttcttattcttttgattttccacgctttca |
30947152 |
T |
 |
Q |
149 |
ctttcgttcgttctctctgttctccctcgccatttccgttctctcccttcgacattcccaatcaacactcgatc |
222 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30947153 |
ctttcgttcgttctctctgttctccctcgccatttccgttctctcccttcgacattcccaatcaacactcgatc |
30947226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1807 times since January 2019
Visitors: 2393