View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0202_low_14 (Length: 263)
Name: NF0202_low_14
Description: NF0202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0202_low_14 |
 |  |
|
| [»] scaffold0221 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 31 - 190
Target Start/End: Original strand, 21658677 - 21658836
Alignment:
| Q |
31 |
agggcctccaaccctaaattcagtgttgtttgggtgttgaattcctttatcatgatttttcaaggtgtgtttcaactaagactcgtgatattgatttata |
130 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21658677 |
agggcctctaaccctacattcagtgttgtttgggtgttgaattcctttatcatgattcttcaaggtgtgtttcaactaagactcgtgatattgatttata |
21658776 |
T |
 |
| Q |
131 |
tgtaagaaatttgagaatcgtacatcatctaacattaattaagagaaacgttatgtaacc |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21658777 |
tgtaagaaatttgagaatcgtacatcatctaacattaattaagagaaacgttatgtaacc |
21658836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 204 - 238
Target Start/End: Original strand, 11633642 - 11633676
Alignment:
| Q |
204 |
aacaacttttgcaataactttctctctcatattca |
238 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
11633642 |
aacaacttttgcaacaactttctctctcatattca |
11633676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 203 - 238
Target Start/End: Original strand, 20118809 - 20118844
Alignment:
| Q |
203 |
taacaacttttgcaataactttctctctcatattca |
238 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
20118809 |
taacaacttttgcaataactttctctcttatattca |
20118844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0221 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0221
Description:
Target: scaffold0221; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 205 - 239
Target Start/End: Original strand, 8244 - 8278
Alignment:
| Q |
205 |
acaacttttgcaataactttctctctcatattcat |
239 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8244 |
acaacttttgcaacaactttctctctcatattcat |
8278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 205 - 239
Target Start/End: Original strand, 15267814 - 15267848
Alignment:
| Q |
205 |
acaacttttgcaataactttctctctcatattcat |
239 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15267814 |
acaacttttgcaacaactttctctctcatattcat |
15267848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 201 - 234
Target Start/End: Original strand, 43441764 - 43441797
Alignment:
| Q |
201 |
tgtaacaacttttgcaataactttctctctcata |
234 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
43441764 |
tgtaacaacttttgcaacaactttctctctcata |
43441797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 205 - 238
Target Start/End: Complemental strand, 30136056 - 30136023
Alignment:
| Q |
205 |
acaacttttgcaataactttctctctcatattca |
238 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
30136056 |
acaacttttgcaacaactttctctctcatattca |
30136023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 205 - 238
Target Start/End: Complemental strand, 43573584 - 43573551
Alignment:
| Q |
205 |
acaacttttgcaataactttctctctcatattca |
238 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
43573584 |
acaacttttgcaacaactttctctctcatattca |
43573551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University