View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0202_low_9 (Length: 297)

Name: NF0202_low_9
Description: NF0202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0202_low_9
NF0202_low_9
[»] chr1 (4 HSPs)
chr1 (71-174)||(252630-252733)
chr1 (1-42)||(252727-252768)
chr1 (168-233)||(234405-234471)
chr1 (184-243)||(252329-252392)


Alignment Details
Target: chr1 (Bit Score: 92; Significance: 1e-44; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 71 - 174
Target Start/End: Complemental strand, 252733 - 252630
Alignment:
71 taacctagactattcaccctctactcacactcatcaagtaatcaatgagcacatatcaaatatttgaaccctataatgtagcaaacttgcataatacaaa 170  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |    
252733 taacctagactattcaccctctactcacactcatcaagtaatcaatgagcacagatcaaatatttgacccctataatgtagcaaacttgcataatacaga 252634  T
171 tcaa 174  Q
    ||||    
252633 tcaa 252630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 252768 - 252727
Alignment:
1 gtgcagaacaaggttgaccattattcaaataattataaccta 42  Q
    ||||||||||||||||||||||||||||||||||||||||||    
252768 gtgcagaacaaggttgaccattattcaaataattataaccta 252727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 168 - 233
Target Start/End: Original strand, 234405 - 234471
Alignment:
168 aaatcaagtaaataatgagtttgaataatcaac--tagaaattataactcttcaatatatcaaacatg 233  Q
    |||||||| ||||||||||||||||||||||||  ||||||||||||||| |||||||||| ||||||    
234405 aaatcaag-aaataatgagtttgaataatcaactatagaaattataactcgtcaatatatcgaacatg 234471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 184 - 243
Target Start/End: Complemental strand, 252392 - 252329
Alignment:
184 gagtttgaataatcaa----ctagaaattataactcttcaatatatcaaacatgaaatcaacta 243  Q
    ||||||||||||||||    |||||||||||||||||||||||| |||||||| ||||||||||    
252392 gagtttgaataatcaatcatctagaaattataactcttcaatatttcaaacatcaaatcaacta 252329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University