View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0202_low_9 (Length: 297)
Name: NF0202_low_9
Description: NF0202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0202_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 1e-44; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 71 - 174
Target Start/End: Complemental strand, 252733 - 252630
Alignment:
| Q |
71 |
taacctagactattcaccctctactcacactcatcaagtaatcaatgagcacatatcaaatatttgaaccctataatgtagcaaacttgcataatacaaa |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| | |
|
|
| T |
252733 |
taacctagactattcaccctctactcacactcatcaagtaatcaatgagcacagatcaaatatttgacccctataatgtagcaaacttgcataatacaga |
252634 |
T |
|
| Q |
171 |
tcaa |
174 |
Q |
| |
|
|||| |
|
|
| T |
252633 |
tcaa |
252630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 252768 - 252727
Alignment:
| Q |
1 |
gtgcagaacaaggttgaccattattcaaataattataaccta |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
252768 |
gtgcagaacaaggttgaccattattcaaataattataaccta |
252727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 168 - 233
Target Start/End: Original strand, 234405 - 234471
Alignment:
| Q |
168 |
aaatcaagtaaataatgagtttgaataatcaac--tagaaattataactcttcaatatatcaaacatg |
233 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| ||||||||||||||| |||||||||| |||||| |
|
|
| T |
234405 |
aaatcaag-aaataatgagtttgaataatcaactatagaaattataactcgtcaatatatcgaacatg |
234471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 184 - 243
Target Start/End: Complemental strand, 252392 - 252329
Alignment:
| Q |
184 |
gagtttgaataatcaa----ctagaaattataactcttcaatatatcaaacatgaaatcaacta |
243 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
252392 |
gagtttgaataatcaatcatctagaaattataactcttcaatatttcaaacatcaaatcaacta |
252329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1696 times since January 2019
Visitors: 2393