View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0203-INSERTION-2 (Length: 86)
Name: NF0203-INSERTION-2
Description: NF0203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0203-INSERTION-2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 68; Significance: 5e-31; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 5e-31
Query Start/End: Original strand, 8 - 75
Target Start/End: Original strand, 53695700 - 53695767
Alignment:
| Q |
8 |
gagagaagtttctaaaaaacatcatggtataatttttgtctatgacaggggattatatatcttggcca |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53695700 |
gagagaagtttctaaaaaacatcatggtataatttttgtctatgacaggggattatatatcttggcca |
53695767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.000000000007
Query Start/End: Original strand, 11 - 74
Target Start/End: Original strand, 53688599 - 53688662
Alignment:
| Q |
11 |
agaagtttctaaaaaacatcatggtataatttttgtctatgacaggggattatatatcttggcc |
74 |
Q |
| |
|
|||||||| |||||| ||| ||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
53688599 |
agaagtttttaaaaagaatcttggtatactttttgttcatgacaggggattatatatcttggcc |
53688662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University