View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0203_low_8 (Length: 275)
Name: NF0203_low_8
Description: NF0203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0203_low_8 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 51 - 275
Target Start/End: Complemental strand, 8002976 - 8002740
Alignment:
Q |
51 |
acttctcttatgagaagcttcttatagttctacctctatatttctattgcactttcctccatggtta--------------tacctaggaggatactttc |
136 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
8002976 |
acttttcttatgagaagcttcttatagttctacctctatatttctattgcactttcctccatggttatacccaggaggttatacctaggaggatactttc |
8002877 |
T |
 |
Q |
137 |
agcttaattccatcaataagatatagtattgtttctccaataannnnnnnnnnaagatttctcctataaatactattagtcattacacaagactatcagt |
236 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
8002876 |
agcttaattccatcaataag--atagtattgtttctccgataattttttttttaagatttctcctataaatactattagtcattacacaacactatcagt |
8002779 |
T |
 |
Q |
237 |
tggcaaggataatacataatatacacaaggtttagagtt |
275 |
Q |
|
|
||| || |||||||||||||||| |||| |||||||||| |
|
|
T |
8002778 |
tggtaaagataatacataatatatacaaagtttagagtt |
8002740 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University
This website was viewed 644 times since January 2019
Visitors: 5017