View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0203_low_9 (Length: 262)
Name: NF0203_low_9
Description: NF0203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0203_low_9 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 30 - 262
Target Start/End: Original strand, 49977071 - 49977303
Alignment:
| Q |
30 |
attgggaatgaagttggtttactttatttaattaaggtaaaggaagggtctcatcaaagttgcttaaattggatatttggttacaacagttacaggttat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49977071 |
attgggaatgaagttggtttactttatttaattaaggtaaaggaagggtctcatcaaagttgcttaaattggatatttggttacaacagttacaggttat |
49977170 |
T |
 |
| Q |
130 |
aaggaaaaggaaaacggcgaagatgatgatgatagaaaagacgagaaggtctatgaatgtagattttgttccctcaaattctgcaagtctcaggctcttg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49977171 |
aaggaaaaggaaaacggcgaagatgatgatgatagaaaagacgagaaggtctatgaatgtagattttgttccctcaaattctgcaagtctcaggctcttg |
49977270 |
T |
 |
| Q |
230 |
ggggacacatgaaccgtcatcgccaaggctagc |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
49977271 |
ggggacacatgaaccgtcatcgccaaggctagc |
49977303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 174 - 262
Target Start/End: Complemental strand, 49953557 - 49953469
Alignment:
| Q |
174 |
gaaggtctatgaatgtagattttgttccctcaaattctgcaagtctcaggctcttgggggacacatgaaccgtcatcgccaaggctagc |
262 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||| || |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
49953557 |
gaaggtctatgaatgtagattctgttccctcaagttctgtaaatctcaggctcttgggggacacatgaaccgtcaccgccaaggctagc |
49953469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University