View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0204-INSERTION2 (Length: 227)
Name: NF0204-INSERTION2
Description: NF0204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0204-INSERTION2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 27 - 149
Target Start/End: Complemental strand, 32570738 - 32570616
Alignment:
| Q |
27 |
ctagaatctatgtcgtttgtgccagcaagaacggggagacaaagacaacgttatgaagacaaccttcgacttgtttctgggtaagttttacattttcatg |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32570738 |
ctagaatctatgtcgtttgtgccagcaagaacggggagacaaagacaacgttatgaagacaaccttcgacttgtttctgggtaagttttacattttcatg |
32570639 |
T |
 |
| Q |
127 |
acatagattctttaccttcaaaa |
149 |
Q |
| |
|
|||||||||||||| |||||||| |
|
|
| T |
32570638 |
acatagattctttatcttcaaaa |
32570616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University