View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0204-INSERTION5 (Length: 399)
Name: NF0204-INSERTION5
Description: NF0204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0204-INSERTION5 |
 |  |
|
[»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 195 - 399
Target Start/End: Complemental strand, 2418946 - 2418742
Alignment:
Q |
195 |
gtgatctgatgagaaatggggttgtgtgatttgtaggtgaaaaatggcacaaattcatcttcatggtactcttcatgctactatctatgaggttgataag |
294 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2418946 |
gtgatctgatgaaaaatggggttgtgtgatttgtaggtgaaaaatggcacaaattcatcttcatggtactcttcatgctactatctatgaggttgataag |
2418847 |
T |
 |
Q |
295 |
cttaatgctggtggtggtggaaatttcctcagcatggtactgttttattattttattttggtctatttcgatctggtgattcaattgttgatttttagtt |
394 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
2418846 |
cttaatgctggtggtggtggaaatttcctcagcatggtactgttttattattttattttggtctatttggatctggtgattcaattgttgatttttagtt |
2418747 |
T |
 |
Q |
395 |
ttgat |
399 |
Q |
|
|
||||| |
|
|
T |
2418746 |
ttgat |
2418742 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 8 - 112
Target Start/End: Complemental strand, 2419104 - 2419000
Alignment:
Q |
8 |
ttaagttgtattttgatatacaaagttttgttctggctttaaataggttctgctagtggacggtggggttgatcagggttggataacgagttttaaaaag |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
2419104 |
ttaagttgtattttgatatacaaagttttgttctggctttaaatagatcctgctagtggacggtggggttgatcagggttggatatcgagttttaaaaaa |
2419005 |
T |
 |
Q |
108 |
tatag |
112 |
Q |
|
|
||||| |
|
|
T |
2419004 |
tatag |
2419000 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University