View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0204_low_5 (Length: 243)

Name: NF0204_low_5
Description: NF0204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0204_low_5
NF0204_low_5
[»] chr7 (1 HSPs)
chr7 (133-219)||(10216881-10216967)


Alignment Details
Target: chr7 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 133 - 219
Target Start/End: Complemental strand, 10216967 - 10216881
Alignment:
133 atgaaggacagaaacttcgttttcgtgttcgagcagaccacatgctgtaaccggtgttgtctttgaaagtatacataactttgaagc 219  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10216967 atgaaggacagaaacttcgttttcgtgttccagcagaccacatgctgtaaccggtgttgtctttgaaagtatacataactttgaagc 10216881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University