View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0204_low_6 (Length: 242)
Name: NF0204_low_6
Description: NF0204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0204_low_6 |
 |  |
|
| [»] scaffold0150 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 30 - 146
Target Start/End: Original strand, 52133674 - 52133790
Alignment:
| Q |
30 |
caattccagcagaagagacaggagctcttgggttcaagagttcgtctttagtttggttttgttccatataattatcagacagagtttcaacactatgata |
129 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52133674 |
caattccagcagaagagacaggagctattgggttcaagagttcctccttagtttggttttgttccatataattatcagacagagtttcaacactatgata |
52133773 |
T |
 |
| Q |
130 |
gaggttacctttgctac |
146 |
Q |
| |
|
|||||||||| |||||| |
|
|
| T |
52133774 |
gaggttacctatgctac |
52133790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0150 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0150
Description:
Target: scaffold0150; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 74 - 138
Target Start/End: Original strand, 8928 - 8992
Alignment:
| Q |
74 |
tctttagtttggttttgttccatataattatcagacagagtttcaacactatgatagaggttacc |
138 |
Q |
| |
|
||||||||||| | |||||||||||||||||| |||| |||||||||||| | |||||| ||||| |
|
|
| T |
8928 |
tctttagtttgttcttgttccatataattatcggacaaagtttcaacactgttatagagattacc |
8992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 74 - 138
Target Start/End: Complemental strand, 17020342 - 17020278
Alignment:
| Q |
74 |
tctttagtttggttttgttccatataattatcagacagagtttcaacactatgatagaggttacc |
138 |
Q |
| |
|
||||||||||||| |||||||||||||| ||| |||| |||||||||||| | |||||| ||||| |
|
|
| T |
17020342 |
tctttagtttggtcttgttccatataatgatcggacaaagtttcaacactgttatagagattacc |
17020278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 74 - 138
Target Start/End: Complemental strand, 17550779 - 17550715
Alignment:
| Q |
74 |
tctttagtttggttttgttccatataattatcagacagagtttcaacactatgatagaggttacc |
138 |
Q |
| |
|
||||||||||||| |||||||||||||| ||| |||| |||||||||||| | |||||| ||||| |
|
|
| T |
17550779 |
tctttagtttggtcttgttccatataatgatcggacaaagtttcaacactgttatagagattacc |
17550715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University