View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0206Eco15 (Length: 409)
Name: NF0206Eco15
Description: NF0206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0206Eco15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 1e-97; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 9 - 193
Target Start/End: Original strand, 41277645 - 41277829
Alignment:
| Q |
9 |
atgagtccatcaatatcggtacggttgcattcattctcttggctacaatcaacactttcaatcggaatcgacaacgaagaagcctctcctccttcaattc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41277645 |
atgagtccatcaatatcggtacggttgcattcattctcttggctacaatcaacactttcaatcggaatcgacaacgaagaagcctctcctccttcaattc |
41277744 |
T |
 |
| Q |
109 |
tgcggcgtttgtttatctcgtcgccgggaataacacttacttcgtcggatcgggaaaccctagacgacggcacatcgggaacata |
193 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41277745 |
tgcggcgtttgtttctctcgtcgccgggaataacacttacttcgtcggatcgggaaaccctagacgacggcacatcgggaacata |
41277829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 155; E-Value: 4e-82
Query Start/End: Original strand, 243 - 405
Target Start/End: Original strand, 41277879 - 41278041
Alignment:
| Q |
243 |
ccggagtggccgtttagtactaaattgatgaatctgggatctgctccggcgtccatgagttgttctcgggtgggaattgcgctttcgtcgaagttgcgga |
342 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41277879 |
ccggagtggccgtttaggactaaattaatgaatctgggatctgctccggcgtccatgagttgttctcgggtgggaattgcgctttcgtcgaagttgcgga |
41277978 |
T |
 |
| Q |
343 |
actcaacgggaatgtcgtcgtcgaagggaaaatcgttgaacggaaaatccattacggtgaatt |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41277979 |
actcaacgggaatgtcgtcgtcgaagggaaaatcgttgaacggaaaatccattacggtgaatt |
41278041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University