View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0206_low_4 (Length: 336)
Name: NF0206_low_4
Description: NF0206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0206_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 87 - 271
Target Start/End: Original strand, 40751831 - 40752015
Alignment:
Q |
87 |
aaaattccaagaggcaagagaactagaaggtgtattatcatagaatcttccattctcataatcaattcttgtggtgtaagggaaattaagtatagaggag |
186 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
40751831 |
aaaattccaagaggcaagagaactagaaggtgtattatcatagaatcttccattctcatatccaattcttgtggtgtaagggaaattaagtatagaggag |
40751930 |
T |
 |
Q |
187 |
ttagaaaaaacttcttgaaaacttctcttgccacataacttggattgttccctttgttttctagccattataacatgcctatgat |
271 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
40751931 |
ttagaaaaaacttcttgaaaacttctcttgccacataacttggattgttccctttgttttctagccattataacatgccaatgat |
40752015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1438 times since January 2019
Visitors: 2391