View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0206_low_5 (Length: 280)
Name: NF0206_low_5
Description: NF0206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0206_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 96 - 206
Target Start/End: Original strand, 47791593 - 47791703
Alignment:
| Q |
96 |
gaagaatttgttaggtgtttgatttcctgatgtttgtttgtaatttcgtctgtaaaaaacagggggcaatccgggatgctgttgaagattctattacttg |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47791593 |
gaagaatttgttaggtgtttgatttcctgatgtttgtttgtaatttcgtctgtaaaaaacagggggcaatccgggatgctgttgaagattctattacttg |
47791692 |
T |
 |
| Q |
196 |
gcctgtgagaa |
206 |
Q |
| |
|
||||||||||| |
|
|
| T |
47791693 |
gcctgtgagaa |
47791703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University