View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0206_low_6 (Length: 206)
Name: NF0206_low_6
Description: NF0206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0206_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 18 - 161
Target Start/End: Complemental strand, 25524574 - 25524433
Alignment:
| Q |
18 |
cctgggaggtattttactttacattcatatactgtcttatgacnnnnnnnnctgtcttcttttaaaactcatacatgctcttgtcattccggttaatatt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| || |||||| |||||| |||||||||||||||| |
|
|
| T |
25524574 |
cctgggaggtattttactttacattcatatactctcttatgacttttttt-ctgtcttcttttaaa-ctaatacatactcttggcattccggttaatatt |
25524477 |
T |
 |
| Q |
118 |
tcaggttcttccgctacatgcttttattgcttatggtgcaccaa |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25524476 |
tcaggttcttccgctacatgcttttattgcttatggtgcaccaa |
25524433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 153 - 191
Target Start/End: Original strand, 25524770 - 25524808
Alignment:
| Q |
153 |
gtgcaccaatgcataaaatagtgcagacatgtagagatt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25524770 |
gtgcaccaatgcataaaatagtgcagacatgtagagatt |
25524808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University