View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0206_low_6 (Length: 206)

Name: NF0206_low_6
Description: NF0206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0206_low_6
NF0206_low_6
[»] chr3 (2 HSPs)
chr3 (18-161)||(25524433-25524574)
chr3 (153-191)||(25524770-25524808)


Alignment Details
Target: chr3 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 18 - 161
Target Start/End: Complemental strand, 25524574 - 25524433
Alignment:
18 cctgggaggtattttactttacattcatatactgtcttatgacnnnnnnnnctgtcttcttttaaaactcatacatgctcttgtcattccggttaatatt 117  Q
    ||||||||||||||||||||||||||||||||| |||||||||        ||||||||||||||| || |||||| |||||| ||||||||||||||||    
25524574 cctgggaggtattttactttacattcatatactctcttatgacttttttt-ctgtcttcttttaaa-ctaatacatactcttggcattccggttaatatt 25524477  T
118 tcaggttcttccgctacatgcttttattgcttatggtgcaccaa 161  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
25524476 tcaggttcttccgctacatgcttttattgcttatggtgcaccaa 25524433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 153 - 191
Target Start/End: Original strand, 25524770 - 25524808
Alignment:
153 gtgcaccaatgcataaaatagtgcagacatgtagagatt 191  Q
    |||||||||||||||||||||||||||||||||||||||    
25524770 gtgcaccaatgcataaaatagtgcagacatgtagagatt 25524808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2219 times since January 2019
Visitors: 2399