View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0207_high_10 (Length: 234)
Name: NF0207_high_10
Description: NF0207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0207_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 19755770 - 19755892
Alignment:
| Q |
1 |
caattcgaatctcataaacagttgctttttcagcaactttgatggatttaagtgaaacatcggactagaagaaaaatttggtgttagtaaattttgaaaa |
100 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
19755770 |
caattcgaatctcagaaacaattgctttttcagcaactttgatggatttaagtgaaacatcggactagaagaaaaaattggtgttagtaaattttggaaa |
19755869 |
T |
|
| Q |
101 |
gaaaataccaatgcacacaaatg |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
19755870 |
gaaaataccaatgcacacaaatg |
19755892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2223 times since January 2019
Visitors: 2399