View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0207_high_10 (Length: 234)

Name: NF0207_high_10
Description: NF0207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0207_high_10
NF0207_high_10
[»] chr5 (1 HSPs)
chr5 (1-123)||(19755770-19755892)


Alignment Details
Target: chr5 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 19755770 - 19755892
Alignment:
1 caattcgaatctcataaacagttgctttttcagcaactttgatggatttaagtgaaacatcggactagaagaaaaatttggtgttagtaaattttgaaaa 100  Q
    |||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||    
19755770 caattcgaatctcagaaacaattgctttttcagcaactttgatggatttaagtgaaacatcggactagaagaaaaaattggtgttagtaaattttggaaa 19755869  T
101 gaaaataccaatgcacacaaatg 123  Q
    |||||||||||||||||||||||    
19755870 gaaaataccaatgcacacaaatg 19755892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University