View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0207_high_6 (Length: 260)
Name: NF0207_high_6
Description: NF0207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0207_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 30 - 249
Target Start/End: Original strand, 3529008 - 3529227
Alignment:
| Q |
30 |
acaaattccttcaaatcaacgagctcaagtgtgttcccacaatagctctaaatttgatatcactgcacgaactgaattgtgattctgcatatatacttgt |
129 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3529008 |
acaaattccttcgaatcaacgagctcaagcgtgttcccacaatagctctaaatttgatatcactgcacgaactgaattgtgattctgcatatataattgt |
3529107 |
T |
 |
| Q |
130 |
attgttgttaacaacaatcagtaagaaatgtcgtcagacttccatatcgggaggaagactttcgatacaagtatccatacatggatcaaccaccaacttt |
229 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3529108 |
attgttgttaacaacaatcaataagaaatgtcgtcagacttccatatcggaaggaagactttcgatacaagtatccatacatggatcaaccaccaacttt |
3529207 |
T |
 |
| Q |
230 |
gtttgtgcttcaatgttcat |
249 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
3529208 |
gtttgtgcttcaatgttcat |
3529227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University