View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0207_high_9 (Length: 251)
Name: NF0207_high_9
Description: NF0207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0207_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 30 - 250
Target Start/End: Original strand, 47590700 - 47590920
Alignment:
Q |
30 |
cctttcacgtattgatacaagtgctccaaaatttcaccaattcaatttggccaatagttctaacctcaacctgctgcatagattcacaacttggaaactg |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47590700 |
cctttcacgtattgatacaagtgctccaaaatttcaccaattcaatttggccaatagttctaacctcaacctgctgcatagattcacaacttggaaactg |
47590799 |
T |
 |
Q |
130 |
gcagatatcttacatgaagtggggaatttacagacaggggatagaaccattaagaattatgaaacaagatcagtaaaattgaatgatcttcaacccatat |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47590800 |
gcagatatcttacatgaagtggggaatttacagacaggggatagaaccattaagaattatgaaacaagatcagtaaaattgaatgatcttcaacccatat |
47590899 |
T |
 |
Q |
230 |
atactcttgctcaatgtacgc |
250 |
Q |
|
|
| ||||||||||||||||||| |
|
|
T |
47590900 |
acactcttgctcaatgtacgc |
47590920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University