View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0207_low_12 (Length: 251)
Name: NF0207_low_12
Description: NF0207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0207_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 3529217 - 3529458
Alignment:
Q |
1 |
tcaatgttcatataaatcggtcacatagttgcaccaatggctctgagcaggtcacctcgaaccataagatttggtacctcttttgg-nnnnnnntccaca |
99 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
3529217 |
tcaatgttcatataaatcggtcacatagttgcaccaatggctctgagcaggtcacctcgaaccataagatttggtacctcttttggaaaaaaaatccaca |
3529316 |
T |
 |
Q |
100 |
cacgtcaaagattaatttacaagtctatagatcttaaataagcacttcataaagataaagatagtaatagaacacattattgcaaatgagatcacacgat |
199 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3529317 |
cacgtcaaagattaatttacaagtctatagatcttaaataagcacttc------ataaaaatagtaatagaacacattattgcaaatgagatcacacgat |
3529410 |
T |
 |
Q |
200 |
tgtaatcaaata--cgagagttacaaagaacgataatattcatctcac |
245 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
T |
3529411 |
tgtaatcaaatatgagagagttacaaagaacgataatattcatttcac |
3529458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2092 times since January 2019
Visitors: 2396