View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0207_low_14 (Length: 234)
Name: NF0207_low_14
Description: NF0207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0207_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 19755770 - 19755892
Alignment:
Q |
1 |
caattcgaatctcataaacagttgctttttcagcaactttgatggatttaagtgaaacatcggactagaagaaaaatttggtgttagtaaattttgaaaa |
100 |
Q |
|
|
|||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
T |
19755770 |
caattcgaatctcagaaacaattgctttttcagcaactttgatggatttaagtgaaacatcggactagaagaaaaaattggtgttagtaaattttggaaa |
19755869 |
T |
 |
Q |
101 |
gaaaataccaatgcacacaaatg |
123 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
19755870 |
gaaaataccaatgcacacaaatg |
19755892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2009 times since January 2019
Visitors: 2396