View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0207_low_4 (Length: 397)
Name: NF0207_low_4
Description: NF0207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0207_low_4 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 46 - 397
Target Start/End: Original strand, 19755174 - 19755525
Alignment:
| Q |
46 |
catcagtgtcagtgtgctttgtatcatcttcagagttcaacccacgaggttctttactttttccaccttcgaccggagatggacccccttcattttcttc |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
19755174 |
catcagtgtcagtgtgctttgtatcatcttcagagttcaacccacgaggttctttactttttccactttcgaccagagatggacccccttcattttcttc |
19755273 |
T |
|
| Q |
146 |
ataaatgtgttgttgatcatcttcaacacttttagcattcaaatcttgaggaggttcagaaagcattttctctcggtcttcatcatctttgggaggacta |
245 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19755274 |
atcaatgtgttgttgatcatcttcaacacttttatcattcaaatcttgaggaggttcagaaagcattttctctgggtcttcatcatctttgggaggacta |
19755373 |
T |
|
| Q |
246 |
gagtcaactatcatattgtcctcaaagatggggtcaattgactggttaaaagtggaaggaggtgtttgttgcttgcccgtttcggcattgctaactttag |
345 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
19755374 |
gagtcaattatcatattgtcctcaaagatggggttaattgactggttaaaagtggaaggaggtgtttgttgcttgcccgtttcggcattgctaacttcag |
19755473 |
T |
|
| Q |
346 |
cacccttaaacacataaaaaagtcgaagtaaataaagaaggcttgttaaaga |
397 |
Q |
| |
|
|||||| |||||||| ||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
19755474 |
caccctgaaacacattaaaaagtcgaagttaataaagaaggtttgttaaaga |
19755525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 108 - 208
Target Start/End: Complemental strand, 8135228 - 8135128
Alignment:
| Q |
108 |
ccaccttcgaccggagatggacccccttcattttcttcataaatgtgttgttgatcatcttcaacacttttagcattcaaatcttgaggaggttcagaaa |
207 |
Q |
| |
|
|||| |||||| |||||||||||||||| | ||| |||| | |||| || ||||||||||||| |||| | ||||| ||||||||| | | ||||||| |
|
|
| T |
8135228 |
ccactttcgactagagatggacccccttcgtcttcctcatcagtgtgatgctgatcatcttcaatacttctggcatttgaatcttgagaatgatcagaaa |
8135129 |
T |
|
| Q |
208 |
g |
208 |
Q |
| |
|
| |
|
|
| T |
8135128 |
g |
8135128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1104 times since January 2019
Visitors: 2389