View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0207_low_7 (Length: 310)
Name: NF0207_low_7
Description: NF0207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0207_low_7 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 48 - 310
Target Start/End: Original strand, 19755263 - 19755525
Alignment:
| Q |
48 |
tcattttcttcataaatgtgttgttgatcatcttcaacacttttagcattcaaatcttgaggaggttcagaaagcattttctctcggtcttcatcatctt |
147 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19755263 |
tcattttcttcatcaatgtgttgttgatcatcttcaacacttttatcattcaaatcttgaggaggttcagaaagcattttctctgggtcttcatcatctt |
19755362 |
T |
|
| Q |
148 |
tgggaggactagagtcaactatcatattgtcctcaaagatggggtcaattgactggttaaaagtggaaggaggtgtttgttgcttgcccgtttcggcatt |
247 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19755363 |
tgggaggactagagtcaattatcatattgtcctcaaagatggggttaattgactggttaaaagtggaaggaggtgtttgttgcttgcccgtttcggcatt |
19755462 |
T |
|
| Q |
248 |
gctaactttagcacccttaaacacataaaaaagtcgaagtaaataaagaaggcttgttaaaga |
310 |
Q |
| |
|
|||||||| |||||||| |||||||| ||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
19755463 |
gctaacttcagcaccctgaaacacattaaaaagtcgaagttaataaagaaggtttgttaaaga |
19755525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1609 times since January 2019
Visitors: 2392