View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0208-INSERTION-19 (Length: 161)
Name: NF0208-INSERTION-19
Description: NF0208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0208-INSERTION-19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 34; Significance: 0.0000000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 14 - 54
Target Start/End: Original strand, 34995852 - 34995893
Alignment:
| Q |
14 |
cgaagatcatactaa-cataaaaatgacatggaagcttctta |
54 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
34995852 |
cgaagatcatactaaacataaaaatgacatggaagcttctta |
34995893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 117 - 161
Target Start/End: Original strand, 34995961 - 34996005
Alignment:
| Q |
117 |
gcctaccaccccagctttacgagctatccaaatttctattatatc |
161 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
34995961 |
gcctatcaccccagctgtacgagctatccaaatttctaatatatc |
34996005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1145 times since January 2019
Visitors: 2389