View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0208-INSERTION-19 (Length: 161)

Name: NF0208-INSERTION-19
Description: NF0208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0208-INSERTION-19
NF0208-INSERTION-19
[»] chr4 (2 HSPs)
chr4 (14-54)||(34995852-34995893)
chr4 (117-161)||(34995961-34996005)


Alignment Details
Target: chr4 (Bit Score: 34; Significance: 0.0000000002; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 14 - 54
Target Start/End: Original strand, 34995852 - 34995893
Alignment:
14 cgaagatcatactaa-cataaaaatgacatggaagcttctta 54  Q
    ||||||||||||||| ||||||||||||||||||||||||||    
34995852 cgaagatcatactaaacataaaaatgacatggaagcttctta 34995893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 117 - 161
Target Start/End: Original strand, 34995961 - 34996005
Alignment:
117 gcctaccaccccagctttacgagctatccaaatttctattatatc 161  Q
    ||||| |||||||||| ||||||||||||||||||||| ||||||    
34995961 gcctatcaccccagctgtacgagctatccaaatttctaatatatc 34996005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1145 times since January 2019
Visitors: 2389