View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0208-Insertion-2 (Length: 211)
Name: NF0208-Insertion-2
Description: NF0208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0208-Insertion-2 |
 |  |
|
[»] scaffold0048 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0048 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: scaffold0048
Description:
Target: scaffold0048; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 8 - 159
Target Start/End: Original strand, 84369 - 84521
Alignment:
Q |
8 |
aaagaaaaacgataaacgatctttatgaacgacgaaggagctctaaacataagttatttctacaacaacaaaaccatgtggcannnnnnnatttgatcag |
107 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |||||| ||||||||| |
|
|
T |
84369 |
aaagaaaaacgataaagtatctttatgaacgacgaaggagccctaaacataacttatttctacaacaacaaaaccacgtggcagttttttatttgatcaa |
84468 |
T |
 |
Q |
108 |
atcgtcctactgaaaaggtgaatc-ggaccgaagaatttccctttctttttat |
159 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
84469 |
atcgtcctactgaaaaggtgaatcgggaccgaagaatttccctttctttttat |
84521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0048; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 151 - 211
Target Start/End: Original strand, 84543 - 84603
Alignment:
Q |
151 |
tctttttattgagagaagccctttcttttttgaaaaatagaaaaaagcactaagctcccat |
211 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
84543 |
tctttttattgggagaagccctttcttttttgaaaaatagaaaaaatcactaagctcccat |
84603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University