View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0208-Insertion-5 (Length: 191)
Name: NF0208-Insertion-5
Description: NF0208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0208-Insertion-5 |
 |  |
|
[»] chr3 (2 HSPs) |
 |  |
|
[»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 6e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 29 - 191
Target Start/End: Complemental strand, 29822202 - 29822040
Alignment:
Q |
29 |
attacaatatcagcaacatcaaccttttcaaaaaccacacacgccccaatctcaatttcaacaacaacatgataaatgattgttagagaagtagtgatta |
128 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
T |
29822202 |
attacaatatcagcaacatcaaccttttcaaaaaccacaaacaccccaatctcaatttcaacaacaatatgatagatgattgttagagaagtagtgatta |
29822103 |
T |
 |
Q |
129 |
ttccaattcgagaagggatgggtctcctaaagaagaaaggaaggccggaagtttttctgaata |
191 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
T |
29822102 |
ttccaattcgagaagggatgggtctcctaaaaaagaaaggaaggctggaagtttttctgaata |
29822040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 46 - 97
Target Start/End: Complemental strand, 49333923 - 49333873
Alignment:
Q |
46 |
atcaaccttttcaaaaaccacacacgccccaatctcaatttcaacaacaaca |
97 |
Q |
|
|
|||||||||||||| ||||||| || ||| |||||||||||||||||||||| |
|
|
T |
49333923 |
atcaaccttttcaacaaccacaaacaccc-aatctcaatttcaacaacaaca |
49333873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 98 - 191
Target Start/End: Original strand, 40880222 - 40880315
Alignment:
Q |
98 |
tgataaatgattgttagagaagtagtgattattccaattcgagaagggatgggtctcctaaagaagaaaggaaggccggaagtttttctgaata |
191 |
Q |
|
|
||||| |||||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| | |||||||| |||||| |
|
|
T |
40880222 |
tgatagatgattgttaaagaagtagtgattatcccaattcgagaagggatgagtctcctaaagaagaaaggaaggctgtaagtttttatgaata |
40880315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 28; E-Value: 0.000001
Query Start/End: Original strand, 42 - 97
Target Start/End: Original strand, 1663507 - 1663562
Alignment:
Q |
42 |
caacatcaaccttttcaaaaaccacacacgccccaatctcaatttcaacaacaaca |
97 |
Q |
|
|
||||| |||| ||||||| ||||||| || | ||||||||||||||||||||||| |
|
|
T |
1663507 |
caacaacaactttttcaacaaccacaaacatctcaatctcaatttcaacaacaaca |
1663562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University