View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0208_low_3 (Length: 280)
Name: NF0208_low_3
Description: NF0208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0208_low_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 81; Significance: 4e-38; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 124 - 216
Target Start/End: Complemental strand, 8528287 - 8528195
Alignment:
| Q |
124 |
tcacataatctcttcacccctacctccaattgtgtcacaaaactattaggtatcaaataagtaaaaacattgcgaaggatatggatttcaact |
216 |
Q |
| |
|
||||||| | ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8528287 |
tcacatattatcttcacccctacctccaattatgtcacaaaactattaggtatcaaataagtaaaaacattgcgaaggatatggatttcaact |
8528195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1280 times since January 2019
Visitors: 2391