View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0208_low_3 (Length: 280)

Name: NF0208_low_3
Description: NF0208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0208_low_3
NF0208_low_3
[»] chr6 (1 HSPs)
chr6 (124-216)||(8528195-8528287)


Alignment Details
Target: chr6 (Bit Score: 81; Significance: 4e-38; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 124 - 216
Target Start/End: Complemental strand, 8528287 - 8528195
Alignment:
124 tcacataatctcttcacccctacctccaattgtgtcacaaaactattaggtatcaaataagtaaaaacattgcgaaggatatggatttcaact 216  Q
    ||||||| | ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8528287 tcacatattatcttcacccctacctccaattatgtcacaaaactattaggtatcaaataagtaaaaacattgcgaaggatatggatttcaact 8528195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University