View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0208_low_6 (Length: 216)
Name: NF0208_low_6
Description: NF0208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0208_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 31 - 187
Target Start/End: Complemental strand, 19198825 - 19198669
Alignment:
Q |
31 |
catgcatggttattgaagagttttagaaatgaagtctagacaattacacataagagcatgcaatcagcagcctagtaagttcagaaaaacgagggataaa |
130 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
T |
19198825 |
catgcatggttattgaagagttttagaaatgaagtctagacaattacacataagagcatgcgatcagcagcctagtcagttcagaaaaacgagggataaa |
19198726 |
T |
 |
Q |
131 |
atttcatttgaccttgtgtaaaaactgtcttgaccattatcagcagagaagaaaaag |
187 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
19198725 |
atttcatttgacctcgtgtaaaaactgtcttgaccattttcagcagagaagaaaaag |
19198669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2110 times since January 2019
Visitors: 2396