View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0209_low_12 (Length: 220)
Name: NF0209_low_12
Description: NF0209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0209_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 36 - 202
Target Start/End: Original strand, 49511433 - 49511599
Alignment:
| Q |
36 |
ctgttgcatatagacccatcccaataatctgtgaaatgtttttaaatgttgttaggtgttagaatgtataaagggaactttatgtgattagaaaaataat |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49511433 |
ctgttgcatatagacccatcccaataatctgtgaaatgtttttaaatgttgttaggtgttagaatgtataaagggaactttatgtgattagaaaaataat |
49511532 |
T |
|
| Q |
136 |
gaagtatgttacataattacattacatattatatagtcaacaaggaaataaaataatatgtgaagat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49511533 |
gaagtatgttacataattacattacatattatatagtcaacaaggaaataaaataatatgtgaagat |
49511599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2209 times since January 2019
Visitors: 2399