View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0209_low_6 (Length: 293)
Name: NF0209_low_6
Description: NF0209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0209_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 38 - 285
Target Start/End: Original strand, 16737230 - 16737466
Alignment:
| Q |
38 |
gaaatggattctatgaactatcattttcaaacttggaggttgttaggagagttcattccattggttcttggaatctaaactgtggatttatgaatatctt |
137 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
16737230 |
gaaaaggattctatgaactatcattttcaaacttggaggttgttaggagagttcatttcattggttcgtggaatctaaaccgtggatttatgaatatctt |
16737329 |
T |
 |
| Q |
138 |
cgtgtggatcggagatttcaattcgttattgcaacaaagaacctaagcacgtgttagtgtaaaattttatggcctttcacaagagtattaacgtccaaag |
237 |
Q |
| |
|
|||||||| ||||||| |||| |||||||||||||||||||| |||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
16737330 |
tgtgtggattagagattttaattaattattgcaacaaagaacctaggcacatg-----------ttttatggcctttcacaagagtattaacgtccaaag |
16737418 |
T |
 |
| Q |
238 |
atattgtttgcaatagacagtagtgtaaggactccattagcctatgat |
285 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
16737419 |
atattgtttgcaatagccagtagtgtaaggactccattagcctttgat |
16737466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University