View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0212_low_2 (Length: 309)
Name: NF0212_low_2
Description: NF0212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0212_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 29 - 298
Target Start/End: Original strand, 43288825 - 43289094
Alignment:
Q |
29 |
aaagagaattgttgaaggacggtacgtttgattccctaatgacaccgctgtctcttgtccaattcatatggcatcttccaagccatctcaactaccaaag |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43288825 |
aaagagaattgttgaaggacggtacgtttgattccctaatgacaccgctgtctcttgtccaattcatatggcatcttccaagccatctcaactaccaaag |
43288924 |
T |
 |
Q |
129 |
gagtaaaaacctctttaataaacatttttcatttcaaaaagcattctaattccaatacatataataataatgaaaagatctatgtgttttcctcactcaa |
228 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43288925 |
gagtaaaaacctctttaataaacatttttcatttcaaaaagcattctaattccaatacatataataataatgaaaagatctatgtgttttcctcactcaa |
43289024 |
T |
 |
Q |
229 |
gacactgattgtaataaagaatataaagatgcccttctttcttaatctctccgtcttattgcaaagtata |
298 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43289025 |
gacactgattgtaataaagaatataaagatgcccttctttcttaatctctccgtcttattgcaaagtata |
43289094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1654 times since January 2019
Visitors: 2392