View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214-INSERTION-4 (Length: 53)
Name: NF0214-INSERTION-4
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214-INSERTION-4 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 53; Significance: 2e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 2e-22
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 17108759 - 17108707
Alignment:
Q |
1 |
atgagttgtctccaaaccaacttggaaaaaatgttccaccgtacttttcaatt |
53 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
17108759 |
atgagttgtctccaaaccaacttggaaaaaatgttccaccgtacttttcaatt |
17108707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University