View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_high_102 (Length: 292)
Name: NF0214_high_102
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_high_102 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 79 - 292
Target Start/End: Complemental strand, 21956067 - 21955854
Alignment:
| Q |
79 |
gtttgggtgttatgggagaagggaggtttgtggtggtgttgggcatggtggaagatttgaagggagagataagggtcgtgttggcgggaaatgagagatg |
178 |
Q |
| |
|
||||||| |||||| ||||| ||||||||||| |||| |||||| ||| |||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
21956067 |
gtttgggggttatgagagaatggaggtttgtgatggttttgggcgtggaggaagatttgaagggagaaatgagggtcgtgttggcgggaaatgagagatg |
21955968 |
T |
|
| Q |
179 |
agaggagtttggggttgaggcggtggggccaggggttgattgggggttggactttgaaggaatctgggagggaaggtgtggtggttgtattggcagcgat |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||||| |||| | || | |||||||||||||||||||||||| ||||| |||| |
|
|
| T |
21955967 |
agaggagtttggggttgaggcggtggggccagggtttgattggaggttggattttgtatgattgtgggagggaaggtgtggtggttgtgttggcgacgat |
21955868 |
T |
|
| Q |
279 |
ggcggccgagattg |
292 |
Q |
| |
|
||||| ||||||| |
|
|
| T |
21955867 |
tgcggcggagattg |
21955854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2171 times since January 2019
Visitors: 2399