View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0214_high_104 (Length: 284)

Name: NF0214_high_104
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0214_high_104
NF0214_high_104
[»] chr8 (1 HSPs)
chr8 (37-163)||(2163075-2163201)


Alignment Details
Target: chr8 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 37 - 163
Target Start/End: Original strand, 2163075 - 2163201
Alignment:
37 cattattcgcattttttatgtggtttttctttcgataaaccggccgaagagatcgggaaaaattcccttttaatttggaaaatccttttgacgaaaatct 136  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
2163075 cattattcacattttttatgtggtttttctttcgataaaccggccgaagagatcggaaaaaattcccttttaatttggaaaatccttttgacgaaaatct 2163174  T
137 agaaaatcttagcttggaatctctgca 163  Q
    ||||||| |||||||||||||||||||    
2163175 agaaaatattagcttggaatctctgca 2163201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2032 times since January 2019
Visitors: 2396