View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_high_106 (Length: 279)
Name: NF0214_high_106
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_high_106 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 12 - 252
Target Start/End: Original strand, 45361724 - 45361964
Alignment:
| Q |
12 |
atgtgatgacatcaatggtgccactttacgtggctatgatattagcttatggttcagtgaaatggtggaagatattctctcccgatcaatgctccggcat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45361724 |
atgtgatgacatcaatggtgccactttacgtggctatgatattagcttatggttcagtgaaatggtggaagatattctctcccgatcaatgctccggcat |
45361823 |
T |
 |
| Q |
112 |
caatcgcttggttgctctgtttgcagttcctttactttcattccatttcattgcctctaacaatccttacaaaatgaacacacgcttcctcgtcgcagac |
211 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45361824 |
caatcgcttcgttgctctgtttgcagttcctttactttcattccatttcattgcctctaacaatccttacaaaatgaacacacgcttcctcgtcgcagac |
45361923 |
T |
 |
| Q |
212 |
acacttcaaaagattatcgtcttacttgctctcaccatttg |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45361924 |
acacttcaaaagattatcgtcttacttgctctcaccatttg |
45361964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 12 - 190
Target Start/End: Original strand, 25038544 - 25038722
Alignment:
| Q |
12 |
atgtgatgacatcaatggtgccactttacgtggctatgatattagcttatggttcagtgaaatggtggaagatattctctcccgatcaatgctccggcat |
111 |
Q |
| |
|
|||| |||||| |||||||||||||||| || |||||||| ||||||||||| ||||| ||||||||||| ||||| || || |||||||| || || || |
|
|
| T |
25038544 |
atgtcatgacagcaatggtgccactttatgtagctatgatcttagcttatggatcagtaaaatggtggaaaatattttcacctgatcaatgttcaggaat |
25038643 |
T |
 |
| Q |
112 |
caatcgcttggttgctctgtttgcagttcctttactttcattccatttcattgcctctaacaatccttacaaaatgaac |
190 |
Q |
| |
|
||| || || ||||| || ||||||||||| | ||||||||||||||||| || || ||||||||||||||||||||| |
|
|
| T |
25038644 |
caaccgttttgttgcactctttgcagttccacttctttcattccatttcatagcatcaaacaatccttacaaaatgaac |
25038722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University