View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_high_113 (Length: 269)
Name: NF0214_high_113
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214_high_113 |
 |  |
|
[»] scaffold0617 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 30 - 256
Target Start/End: Original strand, 654466 - 654692
Alignment:
Q |
30 |
catctctcgtagtttgataaattgttcattcttcaatggcattgtcataatatcagcaatttgattctgggtattacggtacttcaatttcacagttcct |
129 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
654466 |
catctctcgtagtttgataaattgttccttcttcaatggttttgtcataatatcagcaatttgattctgggtattacagtacttcaatttcacagttcct |
654565 |
T |
 |
Q |
130 |
tcattcaccaagtctctcaaaaaatgaaacttcacatctatgtgtttacttttgccatggaacacagaatgctttgacaattgtattgttgaactgttat |
229 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
654566 |
tcattcaccaagtctctcaaaaaatgaaacttcacatctatgtgtttacttttgccatggaacacgaaatgctttgacaattgtattgttgaactgttat |
654665 |
T |
 |
Q |
230 |
cacagtacattatgctgccttcatctc |
256 |
Q |
|
|
|||||||||||||||||||||| |||| |
|
|
T |
654666 |
cacagtacattatgctgccttcttctc |
654692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 133 - 196
Target Start/End: Complemental strand, 14247786 - 14247723
Alignment:
Q |
133 |
ttcaccaagtctctcaaaaaatgaaacttcacatctatgtgtttacttttgccatggaacacag |
196 |
Q |
|
|
||||||||||| || | ||| ||||| ||||||||||| ||||||||||| ||||| ||||||| |
|
|
T |
14247786 |
ttcaccaagtccctaagaaagtgaaatttcacatctatatgtttactttttccatgaaacacag |
14247723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0617 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: scaffold0617
Description:
Target: scaffold0617; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 133 - 196
Target Start/End: Original strand, 196 - 259
Alignment:
Q |
133 |
ttcaccaagtctctcaaaaaatgaaacttcacatctatgtgtttacttttgccatggaacacag |
196 |
Q |
|
|
||||||||||| || | ||| ||||| ||||||||||| ||||||||||| ||||| ||||||| |
|
|
T |
196 |
ttcaccaagtccctaagaaagtgaaatttcacatctatatgtttactttttccatgaaacacag |
259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0617; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 133 - 196
Target Start/End: Original strand, 5640 - 5703
Alignment:
Q |
133 |
ttcaccaagtctctcaaaaaatgaaacttcacatctatgtgtttacttttgccatggaacacag |
196 |
Q |
|
|
||||||||||| || | ||| ||||| ||||||||||| ||||||||||| ||||| ||||||| |
|
|
T |
5640 |
ttcaccaagtccctaagaaagtgaaatttcacatctatatgtttactttttccatgaaacacag |
5703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University