View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_high_115 (Length: 268)
Name: NF0214_high_115
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214_high_115 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 36 - 237
Target Start/End: Original strand, 49536589 - 49536790
Alignment:
Q |
36 |
gatttaagctgcaaatcaagggatttcttcacccatttaggatgatatgtcacctgataccaggccgaagctttttgttcatacaacaaannnnnnnctt |
135 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
T |
49536589 |
gatttaagctgcaaatcaagggatttcttcacccatttaggatgatatgtcacctgataccaggccgaagctttttgttcatacaacaaatttttttctt |
49536688 |
T |
 |
Q |
136 |
tatcgcttaattctccaacatctgacttcagtttctcaaaaatttgcctaaattcttttttcagtgcactgtacgagtgcttcagcctctccttaagttc |
235 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49536689 |
tatcgcttaattctccaacatctgacttcagtttctcaaaaatttgcctaaattcttttttcagtgcactgtacgagtgcttcagcctctccttaagttc |
49536788 |
T |
 |
Q |
236 |
cc |
237 |
Q |
|
|
|| |
|
|
T |
49536789 |
cc |
49536790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University