View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_high_117 (Length: 267)
Name: NF0214_high_117
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0214_high_117 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 36 - 243
Target Start/End: Original strand, 49536589 - 49536796
Alignment:
Q |
36 |
gatttaagctgcaaatcaagggatttcttcacccatttaggatgatatgtcacctgataccaggccgaagctttttgttcatacaacaaannnnnnnctt |
135 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
T |
49536589 |
gatttaagctgcaaatcaagggatttcttcacccatttaggatgatatgtcacctgataccaggccgaagctttttgttcatacaacaaatttttttctt |
49536688 |
T |
 |
Q |
136 |
tatcgcttaattctccaacatctgacttcagtttctcaaaaatttgcctaaattcttttttcagtgcactgtacgagtgcttcagcctctccttaagttc |
235 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49536689 |
tatcgcttaattctccaacatctgacttcagtttctcaaaaatttgcctaaattcttttttcagtgcactgtacgagtgcttcagcctctccttaagttc |
49536788 |
T |
 |
Q |
236 |
cctttgct |
243 |
Q |
|
|
|| ||||| |
|
|
T |
49536789 |
cccttgct |
49536796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University