View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_high_119 (Length: 266)
Name: NF0214_high_119
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_high_119 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 44 - 257
Target Start/End: Original strand, 173141 - 173355
Alignment:
| Q |
44 |
atatcatggaggctggcacttaccatgataggccaagaactttccctaacatgcgttctaaaccttacaccccgctggtattatcttaccattatatttc |
143 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
173141 |
atatcatggagactggcacttaccatgataggccaagaactttccctaacatgcgttctaaaccttacaccccgctggtattatcttaccattatattt- |
173239 |
T |
 |
| Q |
144 |
cccccattttccaatg--tatctatatatatactctattatcttcttacataattgttttctgcagatatttcgtattctactcggtataaatgttcgtg |
241 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
173240 |
cccccattttccaatgtatatatatatatatactctattatcttcttacataattgttttcttcagatatttcgtattctactcggtataaatgttcgtg |
173339 |
T |
 |
| Q |
242 |
tcctcttcattctttt |
257 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
173340 |
tcctcttcattctttt |
173355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University