View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0214_high_127 (Length: 262)
Name: NF0214_high_127
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0214_high_127 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 37432102 - 37431870
Alignment:
| Q |
1 |
tgcattgatggggatagagtacatgcctttagacaaatcagtaaatgaacttccaatgtttttaacaatgttctgattagaggttcccatgaaaacatgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37432102 |
tgcattgatggggatagagtacatgcctttagacaaatcagtaaatgaacttccaatgtttttaacaatgttctgattagaagttcccatgaaaacatgg |
37432003 |
T |
 |
| Q |
101 |
ataatggatttaaaggaaaccttcttcatctctttcaagagctcgatggggtgcttcatgctagacaattcttctaacgaattgattgcaatgtcctcga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37432002 |
ataatggatttaaaggaaaccttcttcatctctttcaagagctcgatggggtgcttcatgctagacaattcttctaacgaattgattgcaatgtcctcga |
37431903 |
T |
 |
| Q |
201 |
gacgttctaggtacatgtctaacaccttgtgac |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
37431902 |
gacgttctaggtacatgtctaacaccttgtgac |
37431870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University