View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0214_high_127 (Length: 262)

Name: NF0214_high_127
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0214_high_127
NF0214_high_127
[»] chr8 (1 HSPs)
chr8 (1-233)||(37431870-37432102)


Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 37432102 - 37431870
Alignment:
1 tgcattgatggggatagagtacatgcctttagacaaatcagtaaatgaacttccaatgtttttaacaatgttctgattagaggttcccatgaaaacatgg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
37432102 tgcattgatggggatagagtacatgcctttagacaaatcagtaaatgaacttccaatgtttttaacaatgttctgattagaagttcccatgaaaacatgg 37432003  T
101 ataatggatttaaaggaaaccttcttcatctctttcaagagctcgatggggtgcttcatgctagacaattcttctaacgaattgattgcaatgtcctcga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37432002 ataatggatttaaaggaaaccttcttcatctctttcaagagctcgatggggtgcttcatgctagacaattcttctaacgaattgattgcaatgtcctcga 37431903  T
201 gacgttctaggtacatgtctaacaccttgtgac 233  Q
    |||||||||||||||||||||||||||||||||    
37431902 gacgttctaggtacatgtctaacaccttgtgac 37431870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University