View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0214_high_14 (Length: 515)

Name: NF0214_high_14
Description: NF0214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0214_high_14
NF0214_high_14
[»] chr7 (2 HSPs)
chr7 (79-346)||(21955800-21956067)
chr7 (379-407)||(21955629-21955657)
[»] chr5 (1 HSPs)
chr5 (470-510)||(17810526-17810566)


Alignment Details
Target: chr7 (Bit Score: 180; Significance: 6e-97; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 180; E-Value: 6e-97
Query Start/End: Original strand, 79 - 346
Target Start/End: Complemental strand, 21956067 - 21955800
Alignment:
79 gtttgggtgttatgggagaagggaggtttgtggtggtgttgggcatggtggaagatttgaagggagagataagggtcgtgttggcgggaaatgagagatg 178  Q
    ||||||| |||||| ||||| ||||||||||| |||| |||||| ||| |||||||||||||||||| || |||||||||||||||||||||||||||||    
21956067 gtttgggggttatgagagaatggaggtttgtgatggttttgggcgtggaggaagatttgaagggagaaatgagggtcgtgttggcgggaaatgagagatg 21955968  T
179 agaggagtttggggttgaggcggtggggccaggggttgattgggggttggactttgaaggaatctgggagggaaggtgtggtggttgtattggcagcgat 278  Q
    |||||||||||||||||||||||||||||||||| |||||||| ||||||| |||| | || | |||||||||||||||||||||||| |||||  ||||    
21955967 agaggagtttggggttgaggcggtggggccagggtttgattggaggttggattttgtatgattgtgggagggaaggtgtggtggttgtgttggcgacgat 21955868  T
279 ggcggcggagattgcggtggagaatcggtggtggtgggagggaatgagagaacgcattttcgttgttg 346  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||    
21955867 tgcggcggagattgcggtggagaatcggtggtggtgggagggaatgagagaacgcattgttgttgttg 21955800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 379 - 407
Target Start/End: Complemental strand, 21955657 - 21955629
Alignment:
379 gccacttccttcacctaaacaccaaatca 407  Q
    |||||||||||||||||||||||||||||    
21955657 gccacttccttcacctaaacaccaaatca 21955629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 470 - 510
Target Start/End: Original strand, 17810526 - 17810566
Alignment:
470 aaaattatccagcaaaatgaaagtacaagagaataatctac 510  Q
    |||||||||||||||||||||||||||||||||||||||||    
17810526 aaaattatccagcaaaatgaaagtacaagagaataatctac 17810566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University